Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG141
Clone ID CSG141
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG141
Sequence
TGGGGAGGGCCGCGCAGTCGGACCGGCTGCTGAGACGAAAGCTTCACTGGGGCAGTCTCCGCATATCATGGGGAGATAGA
CGCTGCTGCCTCTGATTGGCCTTGGTCCTCACAGCTCTAAAAAGAAGCAGGATTCTTGACAAGCTCTATGAGTTGAAGTC
TAAAGCTCGGCAGATTATGAACCAGTTTGGCCCTTCAGCGCTAATCAACCTCTCCAGTTTCTCATCTGTAAAACCAGAGC
CAGCTAGCACCCCGCCACAAGGCTCCATGGCCAATAGCACCACCGTGGGGAAGATAGCAGGCACTCCTGGGACAGGTGGT
CGTCTCAGCCCTGAAAACAACCAGGTATTGACCAAGAAGAAATTACAAGACCTAGTAAGAGAAGTAGATCCTAATGAGCA
GCTGGATGAAGATGTGGAAGAGATGCTGCTACAGATCGCTGATGATTTTATTGAGAGTGTGGTGACAGCTGCCTGCCAGC
TTGCTCGGCACCGCAAGTCCAGCACCCTAGAGGTAAAAGACGTCCAGCTGCATCT
Sequence Type mRNA
Unitrap ID UNI6175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131830312..131845342 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es