Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST212433
Clone ID OST212433
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST212433
Sequence
TTGAGATTCTCTGTGAGCCGCATCTTCTGGTACACTGAATCTCCCGGGGGGCCATCCGCCCGACTGCCCCTGACTCCGGC
AGCGGGGACCCCCCATGGCAGTGGGCACCTCCCCTTGAAACCTGCCAAGCTGGACGCCACAGCCCTGCACGACGACACCT
CGGCCAGCTCCACGCCCATCTCTGAGGCTTGCAGCCATGCGGTCCTCGCCTGCGGCCCGGGCATCCCTGAAGAGTACTAT
GTGAGCGAGGCTGTGGAAGATGCTCCCAGCTACAGAGAGCACCGGGATGCCTGCACCATCACCGACGTGTGCAACAGCAC
CAACCTTCCAGAAGTTGANATCATTAGCCTGCTGGAGGAACAGCTCCCCCATTACAAGCTAAGAGCGGACACCATCTATG
GTTACGACCACGATGACTGGCTGCATACGCCCCTTATCTCCCCAGATGCCAACATCGACCTCACAACTGAGCANATCGAA
GAGACGCTGAAATACTTCCGTAAGTAGCTGGCGCCATCTGGGGGCACAGCCGTGCGATGCCAAGTTCTG
Sequence Type mRNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121273117..121301219 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es