Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG158
Clone ID CSG158
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG158
Sequence
GCAACAGGCGTGGGTCACGGGCTCGCTCGTTCTCTTTCTGCCGCCATCTTGGTTCCGTGATCTCCGCACAAAATGCCCGG
TGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCACAGCCTCAGGCTGAGA
Sequence Type mRNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472670..127473613 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es