Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST212140
Clone ID OST212140
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST212140
Sequence
ACATCGATGCGGACACTGGTGCCATCGTGACTGGCAAGGGGCTGGACCGTGAAACCGCTGGCTGGCACAACATTACTGTG
CTGGCCATGGAAGCAGACAATCATGCTCAGCTATCTCGGGCATCCCTACGGATCCGAATCCTGGACGTGAACGACAATCC
CCCGGAGCTCGCTACACCCTACGAGGCAGCTGTGTGTGAAGACGCCAAGCCAGGCCAGCTCATCCAAACCATCAGTGTGG
TGGACAGAGACGAGCCCCAGGGCGGCCACCGCTTCTATTTCCGTCTGGTACCAGAAGCACCTAGCAACCCTCATTTCTCT
CTGCTGGACATTGAAGATAACACNGCTGGGNTGTNNACNCANCNGGTGGGCTTAAANNGCCANGAGNNGGNCGTGTNTCT
TNTGCCCATAGNTCNGTGTGNACAGCNGNGCCACCCACCCTGAGCAATNCGGANNCCCTGAACATGCGCATCTGCGNTTG
AGACAGACTCGGTANCATGCAGTTCTGCAACACAACCG
Sequence Type mRNA
Unitrap ID UNI22107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164941712..164960779 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053166 (Cdh22) NM_174988 cadherin 22 Gene [Source:MGI (curated);Acc:Cdh22-001]

 
Come back to gene ENSMUSG00000053166


For any suggestions or comments, please send an email to unitrap@crg.es