Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST211899
Clone ID OST211899
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST211899
Sequence
ACTGAGGTGGGGTCTTTCACTCCTTTGTGTGCTCGGCCATGGAGGAGTTCTTCGACCATGTCACTCAGCACCTGCAGCAG
CACATGCATGGCTCTAAGGAAGAAGAGGAAGAGGACCCACTTGAGGAAGAATTCTCCTGCTTGTGGCAGGAATGTGGCTT
TTGCTCTCTGGACAGTTCTGCCGACCTCATCCGCCATGTCTACTTCCACTGCTACCACACCAAGCTAAAACAGNGGGGGC
TGCNAGCCTTACAAAGCCAGGCTGACCTNAGCCCCTGCATCCTGGACTTTCANAGCCGGAACGTCATCCCTGACACCCCT
GACCATTTCCTGTGCCTGTGGGAACATTGCGAGAGTGTCTTCGACAATCCTGAGTGGTTCTATCGGCATGTGGATGCGCA
CAGCCTGTGCTGTGAATACCAAGCTGTCAGCAAGGACAACCATGTGGTGCAGTGTGGCTGGAAAGGCTGTACCTGTACCT
TCAAGGACCGGTGTAAGCTTCGAGAACACCTCCGCAGCCACACCCAGGAGAAGGTGGTGGCCTGTCCCACCTGTGGGGGG
Sequence Type mRNA
Unitrap ID UNI24638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44107015..44110611 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032119 (Mizf) NM_172162 MBD2-interacting zinc finger Gene [Source:MGI Symbol;Acc:MGI:2429620]

 
Come back to gene ENSMUSG00000032119


For any suggestions or comments, please send an email to unitrap@crg.es