Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG199
Clone ID CSG199
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG199
Sequence
TTTTTAGATGGTTTTTTTTAGCCAGTGTCATGATTAAGAACCTGGATACTGGAGAAGAAATACCTTTAAGTCTTGCTGAA
GAGAAGTTGCCAACAGGTATTAATCCTCTCACTCTGCACATCATGAGAAGGACAAAGGAATATGTTAGCAATGATGCCAC
ACAGTCGGTTGATGATTTTTTTAAACAGTTTTTTTTTGTTTTGGCTTCTTTGTCAAAGATCAGATGACCATAGGACTCAA
CTAAAGAAATTCCTTGGAAAATCAGTGAAGAGAGCAAAGCATCTTGCTGAGGAATATGGTGAACGTGCTATAAATAAAGT
TAAAAGCGTAAGAGATGA
Sequence Type mRNA
Unitrap ID UNI6192

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 23338534..23347120 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036769 (Wdr44) NM_175180 WD repeat domain 44 Gene [Source:MGI (curated);Acc:Wdr44-002]

 
Come back to gene ENSMUSG00000036769


For any suggestions or comments, please send an email to unitrap@crg.es