Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG212
Clone ID CSG212
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG212
Sequence
TCTTTCTTTCGGTGCGGCCGGCGCGGGAGCCTGGCGGAGGGTCGCGATGCCGTACGCCAACCAGCCAACAGTGCGGATCA
CGGAACTCACCGAAGAGAACGTCAAGTTCATTATCGAGAACACGGACCTGGCGGTGGCCAATTCCATTCGGATGGTCTTC
ATCTCAGAGGTGCCCATAATAGCCATCGACAGGGTTCAGAGTGACGCCAACTCCTCGGTCGTTCATGACGAATTCATGGC
GCGCAGG
Sequence Type mRNA
Unitrap ID UNI6196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97381421..97384208 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031783 (Polr2c) NM_009090 polymerase (RNA) II (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:109299]

 
Come back to gene ENSMUSG00000031783


For any suggestions or comments, please send an email to unitrap@crg.es