Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG217
Clone ID CSG217
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG217
Sequence
TTTAGATGTGTTCTGATGACGTTTATAAGCATATCAAGGAAG
Sequence Type mRNA
Unitrap ID UNI6197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90965561..90965593 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es