Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST211309
Clone ID OST211309
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST211309
Sequence
GATTGAGAAATTGACCCTGAGGTATCGGCCTTCCTGCAGAAGCTACGAAGCAGGGTACAGATCGGCGTGGTGGGTGGCTC
TGACTACTCTAAGATCGCCGAGCAGCTGGGAGAGGGGGATGAAGTCATTGAGAAGTTTGACTACGTGTTTGCTGAGAATG
GGACAGTGCAGTATAAACACGGACGGCTACTCTCCAAACAGACGATCCAGAACCACCTGGGGGAGGAGCCTCCTGCAGGA
CTTGATCAACTTCTGCCTTAGCTACATGGCCCTGCTCAGACTGCCCAANAAGCGTGGGACCTTCATTGAGTTCCGGAATG
GCATGCCTGAACGTCTCGCCCATTGGCCGCAGCTGCACCCTGGAGGAGAGGATCGAGTT
Sequence Type mRNA
Unitrap ID UNI15916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81786095..81788339 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022474 (Pmm1) NM_013872 phosphomannomutase 1 Gene [Source:MGI (curated);Acc:Pmm1-001]

 
Come back to gene ENSMUSG00000022474


For any suggestions or comments, please send an email to unitrap@crg.es