Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST211186
Clone ID OST211186
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST211186
Sequence
GAGTGGGGTCTTTACCTGTCGTNCTGNCTGTACCTGGCAGAGGTATGAGGAAGGTACCTGNACCCAGGTNATGGTACCTT
GTGGAGCACCAGGCCTGCTGGGGTATGGAACCTTCCAAAAGTGGGCAGCTCTGGTGGTACCTTCTGGGAGGCAGCANCAA
ATATACGTGCTGTGTGGAGCATGAGGGACTGCCTGAGCATCTCACCCTGCNAATGGGAACCCCCACCTCCTTGGCCTGTG
GTTGGAATAACTGTTGGTGTAATTCTCCTTGGGGTTATCATCATTGGAGCACTGATTGCCATTGTGAAGACGAGGANAAA
NAGAGCAGGGGGCTGNC
Sequence Type mRNA
Unitrap ID UNI24652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37106151..37106561 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es