Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG247
Clone ID CSG247
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG247
Sequence
GGTTGTGAGCTCTTCTAGATGGTTAGAGATTACCAACTGCTTCCCGTTCCCCCAGCACACGGAGGATGATGCTGACTTTG
ATGAG
Sequence Type mRNA
Unitrap ID UNI643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 51674015..51674079 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022312 (Eif3h) NM_080635 eukaryotic translation initiation factor 3, subunit H Gene [Source:MGI Symbol;Acc:MGI:1915385]

 
Come back to gene ENSMUSG00000022312


For any suggestions or comments, please send an email to unitrap@crg.es