Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG264
Clone ID CSG264
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG264
Sequence
TTGGTTGTGAGCTCTTCTAGATGGTGATGAAGACTATGATGTCCCAGAGGGGGTAGAAACTGTGAT
Sequence Type mRNA
Unitrap ID UNI6207

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121358403..121358449 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]

 
Come back to gene ENSMUSG00000039230


For any suggestions or comments, please send an email to unitrap@crg.es