Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210985
Clone ID OST210985
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210985
Sequence
ATCTGGCCTTCCGGCAACGCGCAANNCGGNAAGTCGGCTCCTGACTTCACGGCCACAGCGGTGGTGGATGGTGCCTTCAA
GGAAATCAAGCTTTCGGACTACAGNAGGGAAGTACGTGGTCCTCTTTTTCTACCCACTGGACTTCACTTTTGTTTGCCCC
ACGGGAGATCATCGCTTTTAGCGACCATGCTGAGGACTTCCGAAAGCTAGGCTGCGAGGTGCTGGGAGTGTCTGTGGACT
CTCAGTTCACCCACCTGGCGTGGATCAATACCCCACGGAAAGAGGGAGGCTTGGGCCCCCTGAATATCCCTCTGCTTGCT
GACGTGACTAAAAGCTTGTCCCANAATTACGGCGTGTTGAAAAATGATGAGGGCATTGCTTACAGGGGTCTCTTTATCAT
CGATGCCAAGGGTGTCCTTCGCCAGATCACAGTCAATGACCTACCTGTGGGCCGCTCTGTANACGAGGCTCTCCGCCTAG
TCCAGGCCTTTCAGTATACANACNAGCATGGGGAAGTCTGCCCTGCTGGCTGGAAGCCCGGCAGTGACACCATTCAAGCC
CAATGNGGATGACAGCAAGGAATACTTCTCCAAACACAACTGAGATGGGTAAACNTCGGNGAGCCTGAACCTNGGATTTC
ACCTGNGCCCCAACCTGGNAGNTCCTGGGCTGGCCCCAAAAAANGCTANAATTTCCTCCCCTTTTTTGA
Sequence Type mRNA
Unitrap ID UNI22193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87494142..87498081 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005161 (Prdx2) NM_011563 peroxiredoxin 2 Gene [Source:MGI (curated);Acc:Prdx2-003]

 
Come back to gene ENSMUSG00000005161


For any suggestions or comments, please send an email to unitrap@crg.es