Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210879
Clone ID OST210879
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210879
Sequence
CTTCTGCCTGCACCTCTGGCANNAGCCAGCCCTTGGTGGGGTTCTACGAAGTNTATCAAGCAAATATGAGAAGCTGGTAG
ACAGGAGGAGGAACGTGTGGTCCGCAGCCGAGAGATCTTTGACTCCTATATTATGAAAGAAACTGCTGGCCTGCTCACAT
CCCTTTTCAAAGAATGCTACGGAGCATGTCCAGGGCCACCTGGTGAAGAAGCAGGNGCCTCCAGATCTCTTCCAGCCATA
CATTGAGGAGATTTGTCAGAACCTCCGAGGGGACGTGTTCCAGAAGTTTATANAGAGTGACAAGTTCACACGGTTCTGCC
AGTGGAAGAATGTTGAGCTCAACATNCACCTGGACCATGAATGACTTCAG
Sequence Type mRNA
Unitrap ID UNI24663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4291311..4292821 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024858 (Adrbk1) NM_130863 adrenergic receptor kinase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:87940]

 
Come back to gene ENSMUSG00000024858


For any suggestions or comments, please send an email to unitrap@crg.es