Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210755
Clone ID OST210755
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210755
Sequence
GACCCCGTTTGCCCAGGTGCTGGCCAGTCTCCGCAACGTTCGAAGCAACTTCTCACTCCTAACCAATGTGCCCATCCCCA
GCAACAAGAGGTCCCCGCTGGGCGGGCCACCCTCTGTCTGCAAGGCCACACTGTCAGAGGAGACATGCCAGCAGCTGGCC
CGGGAGACCCTGGAAGAGCTGGATTGGTGCCTGGAGCAGCTGGAGACCATGCAGACCTACCGCTCTGTCAGCGAGATGGC
CTCACACAAGTTTAAAAGGATGCTGAACCGGGAACTCACACACCTGTCGGAAATGAGCAGGTCAGGAAACCAGGTCTCAG
AGTACATCATTCCCT
Sequence Type mRNA
Unitrap ID UNI24667

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20996959..21003113 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032177 (Pde4a) NM_019798 phosphodiesterase 4A, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99558]

 
Come back to gene ENSMUSG00000032177


For any suggestions or comments, please send an email to unitrap@crg.es