Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210726
Clone ID OST210726
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210726
Sequence
GGTTGAAAGACCTTAAGAANTATGTCCAGTNCTGAGTTNACACCNGGANNNGCCGGNCNCTACTGNACCTGACTTAGAAG
AGNNTATACCNTGAGGTCNTGCNGGAGAANTNCNACANCTTGANTNNAGNANNNTGTCNANTANNTATTCCTANATTGGC
CCNCTGNTTAAAACAAGAAGAGTCCGAGGTGGCGGAAAGTGCTGTTCCTCAACAATTGGAACTACAACCTACAATTGACG
ATTCANAGCTTGAGAATTATTTTAGGATGCAAAGTTCCAGTGCAACAGAAATGGTGGGTGACTCATCTCTTCACGAGCAG
TCAGGAAACCACAATGAAGAGGACCTATGTGACTCTAAGCCATGTGGGAATGTGTTGGGTGAACAATTATGCCTTAACAC
AGAGGTGANCATGCAAAGTCAAGGATACAGNTNTGAGNGNANCTGGTNTGGGAAGGACATTNTTTNTTTGCTCAAGGAAA
CCTCTACTGGACANACCGTATCTGAGCTTAGTNAGCGGGGAAAACTTTTTCAGG
Sequence Type mRNA
Unitrap ID UNI24669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20304686..20306551 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060510 (5730601F06Rik) NP_001128491 RIKEN cDNA 5730601F06 gene Gene [Source:MGI Symbol;Acc:MGI:1924769]

 
Come back to gene ENSMUSG00000060510


For any suggestions or comments, please send an email to unitrap@crg.es