Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG297
Clone ID CSG297
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG297
Sequence
TAGCTCGAGCAGATGAAGAAACAAGTTCTGTGGGCCGAGAACAAGTGAATAAGGCCTATCATGCATATCGGGAGGTTTGC
ATTGATTGTTTTTTTTTAAACACACGACAGGGTCCGCCTCAGGAAGACATTCTGCAGGGCAGAGATGTCATCAGGCCGAG
CTTGTCGAGAGAAGAGCATGTTCCACACCAGGGTCTTCACCACATGTGATAATATGCAACATGCATATTGGGAATTGAAG
AGGGCGATGTCTAACTCACACATGGCGACTCAAGTGCAAGCAGATCTACTAAGAAAACTGAAAACCTCAGCTGCAGTCAA
GAA
Sequence Type mRNA
Unitrap ID UNI6213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 117958436..117968291 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039285 (Azi2) NM_013727 5-azacytidine induced gene 2 Gene [Source:MGI Symbol;Acc:MGI:1351332]

 
Come back to gene ENSMUSG00000039285


For any suggestions or comments, please send an email to unitrap@crg.es