Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210641
Clone ID OST210641
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210641
Sequence
TCCTACGGTCCCCCAGGTGCACAGCGGTATCCCCTTGGCATGCAGGGCCGGGCTCCAGGGGCCCTGGGAGGCTTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTATGGAACTAGATCTCAGCCTCCTCTGGCCCCTGGAAAATCCAACCATGA
AGACTTGAATTTAATTCAACAGGGAAAGACCATCGAGTCTACCAGTAAGACATTACTATGCTGATTGAAAAATGTAANGG
GTTAAAGGATTCTGNAAACGATCGGTTNGCCTGCTCTGTTTAAATTACACACAGGA
Sequence Type mRNA
Unitrap ID UNI19911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5040682..5127117 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es