Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG317
Clone ID CSG317
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG317
Sequence
CATCCAGGAGACCCGAAGGCAGCCTATCCCTGACCTTGGCCTGATGCCCCTGCCTGATTCAGTTTCAGATTTGGACTGGT
CCAACGTAGTAGATGCCGCCAAAGCCTATGAGT
Sequence Type mRNA
Unitrap ID UNI6216

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83541836..83541947 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es