Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210365
Clone ID OST210365
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210365
Sequence
AGAACTCCAGGAGTTTTACAAGGACACCTACCAAAAGTTACGGAGCAAGGATGAACCCCAGCGGGAAACACTCAAAGCCA
TCCATATGGCGTTGGACTGCTGTGGCATAGCTGGTCCTTTGGAGCAGTTTATCTNGGACACCTGCCCCAANAAACAGCTT
TTGGAAAGTTTCCANGTTAAGCCCTGCCCTGAAGCNATCAGNGAGGTCTTCAACAACAAGTTCCNCATNATTGGAGCAGN
GGGATTCGGCAATCGCCGNGGTGATGATCTTCGGCATGANCTTCAGATGATCCTGNGCTGCGCCATCCGAGNGAGCCGAG
AATGGTCTAGAGTCTG
Sequence Type mRNA
Unitrap ID UNI11992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125410673..125412435 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030342 (Cd9) NM_007657 CD9 antigen Gene [Source:MGI (curated);Acc:Cd9-001]

 
Come back to gene ENSMUSG00000030342


For any suggestions or comments, please send an email to unitrap@crg.es