Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210343
Clone ID OST210343
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210343
Sequence
GACTGAGGTAAAGGTGCTGAAGGAGAAGATAGAAGCTGAGAAGGGTAGAGATGCTTTCCCCGTGGCTGGACAGAAACTCA
TNTATGCTGGCANGATCTTGAGTGACGATGTTCCCATCAAGGAATACCATATAGATGAGAAGAACTTTGTGGTTGTCATG
GTGACCAAGGCCAAAGCTGGCCAGGGTATCCCGGCACCCCCAGAGGCCTCACCCACTGCTGTCCCGGAGCCCTCCACACC
TTTCCCTCCAGTCCTGGCATCAGGCATGTCTCATCCCCCACCTACCAGCAGAGAGGACAAGAGCCCATCAGAGGAGTCAA
CCACCACAACATCTCCAGAATCCATTTNTGGCTCTGTTCCCTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCAGCTTCC
ACATTAGTGACTGGCTCTGAATATGAGACGATGCTGACTGANATCATGTCCATGGGCTACNAGCGGGAGCGGGTTGTGGC
CGCATTGAGGGCCATCTACAACAACCCCCACCGAGCTGTGGAG
Sequence Type mRNA
Unitrap ID UNI24674

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87361918..87362856 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003813 (Rad23a) NM_009010 RAD23a homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rad23a-001]

 
Come back to gene ENSMUSG00000003813


For any suggestions or comments, please send an email to unitrap@crg.es