Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210340
Clone ID OST210340
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210340
Sequence
AGAAGAGACGTTCCTCCTCTAACAACAAGGCGGTAACCACTTTCACGATCACTGTGCGTCCCAAGACCTCCGCTCTGGGC
CTGGGGCGAGCACAGCCTGGCGAGCTGATCCTCAAGCGCTGTGTTCCCATCCATCAGCAGCACAACTATGCTGCACCCTC
ACCCTACGTGGAGAGCGAGGACGCGCCCCCGCAGAAAAAGATCAAGAGCGAGGCTTCTCCACGCCCCCTCAAAAGTGTTG
TTCCAGCAAAAGCGAAGAGCCTGAGCCCCCGAAACTCANACTCGGAGGACAGCGAGCGCCGCCGCAACCACAACATCCTG
GAGCGTCAACGCCGGAACGACCTGCGCTCCANCTTCCTGACNCTNAGGGACCATGTGCCTGANCTGGTGAANAACNANAA
GGCCCCCNAGGTGGTCATNTTGAAAAAGGCCACCANATACGTGCACCCCCTA
Sequence Type mRNA
Unitrap ID UNI24675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12943908..12944359 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037169 (Mycn) NM_008709 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) Gene [Source:MGI Symbol;Acc:MGI:97357]

 
Come back to gene ENSMUSG00000037169


For any suggestions or comments, please send an email to unitrap@crg.es