Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG336
Clone ID CSG336
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG336
Sequence
CACTGAAAGCATAATGTCTCAGCATTCAGGAGGCCGTGAGGAGTGACTCTCCCTATGAGAGTCCTTAAGTGAGAACTAGC
ATTAAATGTCTCTGTGTGAATCTGTTTGGTAACGGGATCTTACACGGATTGAACGGTTGCTTTTCTCCCAACAGAGTGGT
GCAGATGTGAACGCAAAGGACATGCTGCAGATGACAGCTCTGCACTGGGCCACAGAGCACCATCACCGGGATGTCGTTGA
GTTACTTATCAAATATGGAGGTGATGTGTACGCTTTTAGCAAATTTGATAAGTCTGCTTTTGTCATAGCAATGGAGAATA
ACAATATTGAGATTTTGGTCATGCTTCAGGAAGCAATGCAGAATCAGGTGAACA
Sequence Type mRNA
Unitrap ID UNI592

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95004189..95008001 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038766 (Gabpb2) NM_172512 GA repeat binding protein, beta 2 Gene [Source:MGI (curated);Acc:Gabpb2-004]

 
Come back to gene ENSMUSG00000038766


For any suggestions or comments, please send an email to unitrap@crg.es