Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210223
Clone ID OST210223
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210223
Sequence
TGTGTGTGCAGTGCCGTGTGGCCCACTCATCAGGAGCCACATCAGAAATGGAGCAGCCATTCACGGTAGATGATGAAGAC
GAACAAGATCCAGAACCACAGCCGAGGTCAGGAGAACCCATTCAAGTCCTCGATGACGATGCCTGCTGAAGATGCAGAGC
TGATCTTCGTAGGGGTGGAGAAGGTAAAGGAAGATGCTGAGCTTATCTTTGTTGGGGNGACTTCANCTTCCCAGCCTGGN
CTACACATTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75500986..75501221 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]

 
Come back to gene ENSMUSG00000049764


For any suggestions or comments, please send an email to unitrap@crg.es