Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG338
Clone ID CSG338
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG338
Sequence
CCTTACCGAACAAGACTGGAATCTAAAGTGTCACAGGTGCCTGTTGTCACTGAGATGTCCCCTCAGCCCCAGAAGGGCTC
ATGAGTAAGACCCTTACGCTTCTTTCTGTTCAGCTGACCCCATTGCCCAGGTACACCAGGCGTTCTGCAAAAACCTGCTA
GAAAGAGCGTTTTTTTTTTTGGGGGAACCTTTGGTTTGGGGGTTTTTTTGGGGGGTTTTTTTTTTTTTTTAGTGAATTTT
CCAGTGCTCTAGAGTATTTGAAATTACTTCATTCTTTTGTGGACTCTGTGGGATTTGTGACCTCACCATTCTCCAGCAGT
TCCGTGCTCAGGTCGGCCCTT
Sequence Type mRNA
Unitrap ID UNI6220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82024362..82025453 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es