Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210198
Clone ID OST210198
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210198
Sequence
GACTGAGAGCCCCATCATGGGTTCAGGTCCCATAGCACCCCAAAGAACTGCTCAAGGGCCTGGATAGCTTCCTTACCCGG
GACGGAGAAGTGAAGAGTGTGGATGGAATTTCCAAGATCTTCAGTCTAATGAAGGAGGCACGAAAGATGGTGAGTCGGTG
CACGTACTTGAACATAATCCTGCAGACCCGCGCTCCAGAAGTGCTCGTCAAGTTTATTGATGTCNGGTGGCTACAAGCTT
CTGAACAACTGGCTAACATATTCAAAGACCACCAACAACATTCCCTCTCCTACAGCANATTCTGCTGACTCTGCAGCACC
TCCCCGCTCACTGNGGGACCATCTCAAGGCANAACAACACAGCAAAACTAGTGAAGCAGCTCAACAAGTCAAGTGANGAT
GAANAGCTCCGGAAATTGGCATTAATCCCTTGTAAGTGACTGGATGGCTG
Sequence Type mRNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36060254..36063191 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es