Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST210060
Clone ID OST210060
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST210060
Sequence
GAACTGAGCCTAAAGGACTAAAAGGAAAAATGGTAGGACGAGAAAAAAAAGTCATCCATCCGTACAGTAGAAAAGCAGCT
CAGATTACAAGAGAGTCTCACAAACAAGACAAGAAGGAAAGATTTCTAAGCTCCTGCTTTGGAAAATATCTAATTTCTCT
GCACCTTTTGGTTCAAGATTGAAGACTGATAAGGCCTTGCGTCTCAACCTTATTGGNGACAAACTTCAATGGTTTCACAG
TCATCTGGATATGAAAAAAACAAGATATTCAAAGAAAGATGCCTGTGAATTAGTTGAAAGGTACNTTGGATCGGTTCAGC
AGTGAGCTGGAGCANATTGAGTTACAGAACAGCATCAAAGACAGGCAGGGAAGGCGGCACCATTCCCGGGAGGCCGTCAT
CAAGCAGACCCTGGAGCGGGAGCGGCAGCAGTACNAAGGCTATGGCTTTGANATCCCANACATTTTAAACTCTAATACTC
TGCAANACTTTCCGGGAATGGGATTTTGATCTGAANAAATTGCCNAACANTCAAAATGGAGGAAACTTTGTGCTGATGAT
GCACT
Sequence Type mRNA
Unitrap ID UNI12551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 69000742..69008071 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025591 (1810029B16Rik) NM_025465 RIKEN cDNA 1810029B16 gene Gene [Source:MGI Symbol;Acc:MGI:1913532]

 
Come back to gene ENSMUSG00000025591


For any suggestions or comments, please send an email to unitrap@crg.es