Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST209954
Clone ID OST209954
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST209954
Sequence
GGTTCACATTACCTTGCGGTATTTGGTAACCACGNACCGTGTCTGGCACCAGGTCTTCGAGNATTCCCATGTCTTCATTG
TTGGCTACATGAACTACATGCAGTTTATGCGCTTTGACAGTGATGGAACTACTCAGAGGATCCAGGCGCGAGGGCCCTGG
GTGAAGCAGATGGGGCCTGTGTATTTGGAGATGGAAAGAAGGAAAATGGAGAGCTATTCACACAGGGCCCGAGAAAACCT
GCGATTCGCAATCCAGGTCTACAACCAGAGCGACAAGGTTGCAACATGGGGCCAGACCGACGCCTCCTCCGTGGGCACCA
TAGACATGCTTTTGATGGCAGCTATTACATCATTCTGAACTTGGACCGGAAAACATGGACTGAGGCAGACAGTACGGCTC
AGATCACCCAGCGACAGTGGAAGGCAGAAGGTGTAGCAGAGGCCTTCAGCCACTTCTTGAAAGTCTTNTTGTGTTCAGTG
GCTACTGAGGCACTTGGAGATAGGGAAGGAGACTCTACAGCGCTCAGACCCCCCCCCCCAAAAGGGGCCTNGGGAGCCTT
CCCCCCAANCTTGANGGGGGAGNCCCCTTGGGGGGNNGGCCCCTGGACNNTTTCCCTNGTTANNGTNNTTTTGACCTGGA
AAAGGGTTG
Sequence Type mRNA
Unitrap ID UNI14476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37106546..37108059 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es