Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG363
Clone ID CSG363
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG363
Sequence
GCCGGGGTTTTTTTTGTTTTTCCAACTTTTTTTTTGGGGGGCCCCACGGGGGTGGGGGGTTTTTTTTGGGGGTTTTTTTT
TTTTGCATCAAAATTTTTTTAATTTGCAAATTTTTATTTTGCAAATATTTTGGGAGACATCGATTTTTCTCCCCGTGCTC
CCCCGTTCTTTTCTGAGGAGTGCGCTGCGGCGCGCCCCCGGCTGCTCTCGCCGCGATGAGCATAGAGACGCTACTGGAGG
CGGCCCGCTTCCTGGAATGGCAAGCGCAGCAACAACAGAGAGCACGT
Sequence Type mRNA
Unitrap ID UNI210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74644592..74644902 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000282 (Mnt) NM_010813 minute imprinted gene in the Igf2 region Complex/Cluster/Region [Source:MGI (curated);Acc:Mnt-001]

 
Come back to gene ENSMUSG00000000282


For any suggestions or comments, please send an email to unitrap@crg.es