Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG386
Clone ID CSG386
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG386
Sequence
AAAGGGAAGGGGCAGCTGAAGCGGATGACAAGACTGTGTGGGAGGACACGGACCTGGGGCTGTACA
Sequence Type mRNA
Unitrap ID UNI6226

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56448940..56449000 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es