Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG413
Clone ID CSG413
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG413
Sequence
TTTTTTTGGGGGGTTTTTTTTTTGTGCCAAATGTGAAAAACCATTTCTTGGGCATCGCCATTATGAGAGGAAGGGCTTGG
CCTACTGTGAAACTCACTATAATCAGCTGTTTGGTGATGTTTGTTTCCATTGCAACCGTGTCATAGAAGGTGAT
Sequence Type mRNA
Unitrap ID UNI6228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57876723..57879429 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019920 (Lims1) NM_026148 LIM and senescent cell antigen-like domains 1 Gene [Source:MGI (curated);Acc:Lims1-001]

 
Come back to gene ENSMUSG00000019920


For any suggestions or comments, please send an email to unitrap@crg.es