Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST209253
Clone ID OST209253
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST209253
Sequence
AGCCGCCGCCCCGGGGTCTCCGCTGTCTCGCGAGGAGGGTGAAGCGCCCCCTCTGGTGCCTGCCGAGGAGGGGAGGCGCC
GAAGCCGCCGGGTACGCCTTCGCGGATCCTGCCGCCACCGGCCGAGCTTACTGAGCCGGCGGGAGCTGGCTTCCAACGGC
CCAGCGGTTCCTGCCACCGCGTCCTCGGAGATAATGGCCTCAGCTGCTAAGGAATTTAAAATGGACAACTTTTCACCTAA
AGCTGGCACTAGCAAATTGCAGCAGACAGTACCAGCTGATGCGTCTCCTGATTCTAAGTGTCCTATATGCTTGGATAGAT
TTGATAATGTGTCTTACTTAGATCGTTGCCTACATAAGTTCTAAAAAAAAATG
Sequence Type mRNA
Unitrap ID UNI22386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40209943..40215527 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036822 (Topors) NM_134097 topoisomerase I binding, arginine/serine-rich Gene [Source:MGI (curated);Acc:Topors-001]

 
Come back to gene ENSMUSG00000036822


For any suggestions or comments, please send an email to unitrap@crg.es