Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST209248
Clone ID OST209248
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST209248
Sequence
GTCTATGCCCTCCTCTGCGAGCCNTCAGCCCTCTCCGCAACAACGGGCNGACCCCTGGTANTCCNGTACACAGGTGAAGC
CTGCGCAGANGNTGGACNTGCGGTGGTGGTTACNTCAAGGTGTTCCCGTCTGACCTGGACCAGAAGANGANGAACCGGAA
AATCTCAGTACCTACATCATGTTTGGACCTGATATTTGTGGATTTGATATCAAGAAAGTTCATGTTATCTTATATTTCAA
GAATCAATATCATGAAAACAAGAAGCCAATCAGATGCAAGGTGGATGGCTTCACGCATCTCTACACCCTGATCTTAAGAC
CAGATCTTTCTTACGAGGTAAAAGTCGATGGCCAGTCCATTGAGTCTGGCAGCATTGAGTATGACTGGAACCTGACATCG
CTGAGGAAAACGGAAAAGACATCACTGGACTCTAGGGACTGGGATCAGGTGGAAGGCAGTAAAGTCCAGGATTGGGAAAA
GCACTTTCTGGATGCGGGTGCCANCAAGCCGAGTGACTGGAACAGTG
Sequence Type mRNA
Unitrap ID UNI24710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74952007..74962507 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019732 (Calr3) NM_029782 calreticulin 3 Gene [Source:MGI (curated);Acc:Calr3-001]

 
Come back to gene ENSMUSG00000019732


For any suggestions or comments, please send an email to unitrap@crg.es