Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST209205
Clone ID OST209205
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST209205
Sequence
TGGAGGAACCAATAGAAGAAGCTGCTAGGACAGAAACTGCAGCCTGACCCTGTTGGACCCCACCAGTTCACTGAGCCTGA
ATGATGACTGCTGAGTCAAGGGAAACCACAGGTCTATCCCCACAGGCTGCACAGGAGAAAGATGGTATAGTTATTGTGAA
GGTA
Sequence Type mRNA
Unitrap ID UNI24006

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138534154..138534318 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029729 (Zkscan1) NM_133906 zinc finger with KRAB and SCAN domains 1 Gene [Source:MGI (curated);Acc:Zkscan1-001]

 
Come back to gene ENSMUSG00000029729


For any suggestions or comments, please send an email to unitrap@crg.es