Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST208986
Clone ID OST208986
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST208986
Sequence
TTGACTCTATGATGATGNGCATGTGAACTTTACTCGTGAAGAATGGGCTTTGCTGAATCCTTCACAGAAGAGCCTCTACA
AAGATGTGATGTTGGAGACCTACAGGAACCTCAATGCTATAGGCTACAATTGGGAAGACAATAATATTGAAGAACATTGT
CAAAGTTCCAGAAGACATGGAAGGCATGAAAGAAGACTTACTGGAGAGAAACCCTCTGAAAATATTCAGTGTGGTAAAGA
CTTTGCAAGTCACAGTTATCCTCAAAGGCATGAAAAAATTCATACTGGAGAGAAACCCTATGAAGGT
Sequence Type mRNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98287707..98289289 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es