Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST208980
Clone ID OST208980
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST208980
Sequence
ACTGAGAATGATGGAAGAACTGCATAGCCTGGNCCCACGAAGGCAGGAATTACTAGAGGCCAGGTTCACTGGAGTTGGTG
TAAGTAAGGGGCCACTCAACAGTGAGTCTTCCAACCAGAGTCTGTGCAGCGTGGGGTCGTTGAGTGATAAAGAAGTAGAG
ACTCCTGAGAAAAAGCAGAATGACCAGCGAAATCGGAAAAGGAAAGCCGAGCCATATGACACTAGCCAAGGGAAAGGCAC
TCCTANGGGACATAAAATTANNGATTACTTTGAGNNTGCTGNGGNANNNGGCCCAGGAACCAGNCNTGGCAGAAGTGTTN
CANCAGNTGCACNANNCTCACCNGNTCATTCCTTATCCANTNCCTTACCGCGTGGAGCAGAACAGCCTTTGTC
Sequence Type mRNA
Unitrap ID UNI24722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105045527..105082521 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es