Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG446
Clone ID CSG446
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG446
Sequence
TTGTGAGGTTTTTTAGATGGTTGTGAGCTTTTTTAGATGGTTTTTGATCGGCCCCAATATGATACTAACCAAAGCCCAGT
ACGAGGAGATAGCCCAGTGCCTAGTGTCTGTACCGCCCACTAGGCAGAGCCTGAGGAAGCTGAAGCAGAGGTTCCCCAGT
CAATCGCAGGCCACTCTGCTGAGCATCTTCTCCCAGGAGTACCAGAAACATATTAAAAGAACACATGCCAAACATCACAC
TCCAGAAGCGATTGAAAGTTACTACCAG
Sequence Type mRNA
Unitrap ID UNI6234

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 115407600..115457734 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040282 (BC052040) NP_997147 Uncharacterized protein C15orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G0]

 
Come back to gene ENSMUSG00000040282


For any suggestions or comments, please send an email to unitrap@crg.es