Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG452
Clone ID CSG452
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG452
Sequence
CAGGGCAGCGGGTTGCGGGTTGCGGGAGGTGACTGCGGTCTCCCGGCCAGGCTGGCGGCTGCGGGATCGGGACCCGCGTT
CGAGTCTCCTACACCGGGGCTGTGCTTGCTGGCTCCCTTCTCGATCTTCAGCCTGGGCGTCCCATCGGCAGACCTGTGCG
CGCCCGTGGTTCTTGGACCCCGGGCCCAGTTCTTTGGTCC
Sequence Type mRNA
Unitrap ID UNI6237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125450610..125450807 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068394 (Cep152) NM_001081091 centrosomal protein 152 Gene [Source:MGI (curated);Acc:Cep152-001]

 
Come back to gene ENSMUSG00000068394


For any suggestions or comments, please send an email to unitrap@crg.es