Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST208802
Clone ID OST208802
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST208802
Sequence
TCCAAACCTTACTTCCACAACAATGGGACACAATGGGTACCCCAATGGTACTTCAGCAGCACTTCGTGCAAACTGGGGTT
ATTGAAAAACTCTTGACCTCTTACGGGATTCATTCAGTGTTCANAACGGCAAGCTAGGACTTTTCTTCCACTGTTCACAA
TATAATGGCAACCTCCAAGACTTAAAAGTAGGAGATGATGTTGAATTTGAAGTATCATCTGACCGGAGGACTGGGAAACC
TATTGCTATTAAATTGGTGAAGATAAAACCAGAAATACATCCTGAAGAACGAATGAACGGACAAGAAGTATTTTATCTGA
CTTACACCTCTGAAGATGTGGAAGGGAATGTTCAGCTGGAAACTGGAGATAAAATTAACTTTGTAATTGATAACAATAAA
CACACTGGTGCTGTAAAAA
Sequence Type mRNA
Unitrap ID UNI17749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102842626..102845165 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es