Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST208387
Clone ID OST208387
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST208387
Sequence
GACTGAGGAGCTTGTTTAAGAGGCAGTCCCCCTGTCCCTTTGGTTGTTCGAAGCTCCGGAATCTTCTCATTGATGAACTG
TGACTGACAACAGTGGGGTGAGGCTTGGCCGTCTGCTTGACCTGGCCCCAGGTCTATAATTTTATGTAGGATTTCCAGCC
AAAGGTTTCCAAGCTTTCAGTTTTGGGACAGGTTTATGATNTGCTGNGANCGNNGTGAGGAGTGGNTCCATGGTGACTNG
CGTGNNTATNNCTGAGGCCCGANGGCGNCTCCTGGAAANGAACAGGGANAANACTACATCTGCCCAAATTGCACCATTTT
NCANGTGCNGGATNANACAANCGNTANCGCCACCGATGAGCAGGANTNTGNTNGCANATNTGTGGGTGCTGATGGCACAG
ACTGCACNNGCATAGGNACAGTNTACCACGAAGTCCGGACAANACCAAGANATATNGGGNAGGATTGATAAGGNANCANA
CCCCAGCCNCANGATAAANNTCAAGATATTCCAGCCTGTGANTATNTGNCTGCCATGGNAAGCACACATGTAAGACTTTC
TGC
Sequence Type mRNA
Unitrap ID UNI22601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180422135..180426755 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es