Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST208116
Clone ID OST208116
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST208116
Sequence
GACTGAGGCCTTCCCTGAGTTTCCCATGTCTCAATGGACTCCTGAATTTAACGAGCTCTACACCCTAAAAGTGGCTATGA
AGAGTGGGACTCCTGATGCGCCCACTACACAGGAGAGTCTGAAGGCGGTCCTTCTGCACCCACAGCCCCTAGGGGCCACC
AAGAGCTTCCCTGCAGAAGTGGAGATGATTAATAGCAAAGTGGGGAATGAATTCTCTCATCTGTGTGATGATTCTCAAAA
ACAAGAGAAGGACATGACTGGCAACCAGCAAGAACAAGAAAAAAGTGGTGTTGTGAGAAAAAAGCGCAAAAGCCAGCAGG
CTGGCCCCTCATATGTGCAGAACTGTGTCAAAGAAAATCAGGAAATCCTAGGGCGCAGACAACAGCTAGAGACACCGAGT
GATGAGGATAATGACTCTTCCTTAAGTGAGTGTCTGTCTTCTCCCTCATCTAGTCTCCATTTTGGGGGCTCTGATACAGT
GACTTTCAGATGAGGATAAAGAAGTCTCGGTGAGACATACCCAGCCTGTTCTGAGTGCTAAAAGTAGAAGTCACAGTGCA
AGG
Sequence Type mRNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70323920..70324477 551
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es