Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST207842
Clone ID OST207842
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST207842
Sequence
GACTGAGACTCTCAGCGTTCTCATCTCTCCTCCTTCACCATGAAGCTGATGGACAAATTCCACTCTCCCAAAATCAAGAG
AACACCATCCAAGAAGGGAAAGCCAGCCGAGGTGTCGAAGATTCCTGAGAAGCCTGTGAGCAAAGAGGCAAGAGACAGAT
TTCTACCAGAGGGCTACCCTATCCCCTTGGATCTGGAGCANCAGGCNGTAGAATTTATGTCCACCAGTGCTGTGGCTTCC
AGGTCTNAGAGGCAGAAGAACCTGTGCTGGNTGGAGGAGAAAGAGAANGAGGTTGTCAGTGCCTTGCGCTACTTTAAGAC
CATTGTGGACAAAANGGCCATTGATAACAAGGTTNTGGANATGCTCCCGGGGTCAGCCAGCAAGGTGCTGGAGGCCATCT
TACCCCTGGTGCAGACTGACCCTCGGATCCAGCACAG
Sequence Type mRNA
Unitrap ID UNI15349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29534651..29541803 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]

 
Come back to gene ENSMUSG00000039844


For any suggestions or comments, please send an email to unitrap@crg.es