Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST207599
Clone ID OST207599
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST207599
Sequence
CTGAATCTCATCTTTTTCTGGAAAACTGGCAATGAACCATATGGGGATGAACCATATGGAGATGCACCACCATATGGGTA
TGAACCACACGGACGACAACATTACCATGCCACCTCACCACCACCCGACCACCTCAGCCTCACACTCCCACGGTGGAGGG
GACAGCATGATGATGATGCCTATGACCTTCTACTTTGACTTTAAGAATGTGAATCTATTGTTTTCCGGTTTGGTAATCAA
TACACCTGGAGAAATGGCTGGAGCCTTCGTGGCAGTGTTTTTACTAGCAATGTTTTATGAAGGACTCAAGATAGCCCGAG
AGGGTCTGCTTCGAAAGTCTCAAGTCAGCATTCGCTACAATTCCATGCCTGTCCCAGGACCAAATGGAACCATCCTAATG
GAGACACACAAAACTGTTGGGCAGCAGATGCTGAGCTTCCCCCCACCTNCTGCAGACAGTGCTGCACATCATCCAGGTAA
GTCATTCAGCTTACTTCCTTCATGCTCATTTTCATGACCTACAATGGGGTACCCTATGCATTGCAGTAGCAGCAGG
Sequence Type mRNA
Unitrap ID UNI18859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62046535..62049760 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066150 (Slc31a1) NM_175090 solute carrier family 31, member 1 Gene [Source:MGI (curated);Acc:Slc31a1-001]

 
Come back to gene ENSMUSG00000066150


For any suggestions or comments, please send an email to unitrap@crg.es