Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST207596
Clone ID OST207596
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST207596
Sequence
GAAGATGAGGAGCCTCCCAGGAAGGAGAGGGAGAAGGCGAAANGATGACAAAAGTCCGCGGG
Sequence Type mRNA
Unitrap ID UNI24760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12850916..12851372 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024695 (Zfp91) NM_053009 zinc finger protein 91 Gene [Source:MGI (curated);Acc:Zfp91-001]

 
Come back to gene ENSMUSG00000024695


For any suggestions or comments, please send an email to unitrap@crg.es