Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST207447
Clone ID OST207447
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST207447
Sequence
GACTTGAGGTCTTGTTGCAGCATCTGGCAGTGANTCTGAGGAGGAAGACAGCATGGACAGTCCCCTGGACCCNTTCCCTC
ATCAGCAGCCCTCTGGCAAGAGAAGGAGGAGAGGCAATCTGCCCAAGGAGTCAGTCCAGATTCTGCGAGACTGGCTGTAT
GAACACAGATACAACGCCTATCCCTCAGAGCAAGAGAAAGCACTGCTGTCCCAGCAGACACACCTGTCCACACTACAGGT
CTGTAACTGGTTCATCAACGCCCGCCGCAGGCTCCTTCCTGACATGCTGAGAAAGGATGGCAAAGATCCAAATCAGTTCA
CGATTTCCCGCCGTGGGGCCAAGATTTCAGAAGCTAGCTCTATTGAAGCTGCAATGGGTATCAAAAACTTCATGCCAACT
CTAGAAGAGAGCCCATTTCATTCCTGCGTAGTTGGACCCAACCCAACCCTAGGGAGACCAGTGTCTCCCAAACCTCCCTC
CCCAGGATCCATTTTGGCTCGCCCGTCAGTGATCTGCCATACCACTGTGACTGCATTGAAGGATGGGCCTTTCTGGG
Sequence Type mRNA
Unitrap ID UNI16533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71194297..71195740 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]

 
Come back to gene ENSMUSG00000047407


For any suggestions or comments, please send an email to unitrap@crg.es