Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST207350
Clone ID OST207350
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST207350
Sequence
GACTGAGGAGCCCAAGATGTGCGGGTACGAGTGCTTTCCCGAGGTCCGGGGCCGCTTGGGAGGCACCGTGGAGTTACCGT
GCCACCCTGCTTCCCACCCACGACGGAGCGCGTCTCTTCAGGTGACCTGGCAGCGCCTGGATGGCACAGTTGTGGCCTGC
TTTCCACCCATCCCTTCGGAGTGGATTTCCCCAACTCTCAGTTCAGCAAGGACCGTCTGTCCTTTGTCAGAGCGAGACCA
GAAACAAACGCGGACCTGCGGGATGCCACACTGGCCTTCCGGGGACTGAGGGTAGAGGACGAGGGCAATTACACCTGCGA
GTTTGCCACGTTTCCCAACGGTACCCGCAGGGGGGTGACCTGGCTCAGAGTCATAGCCCAGCCTGAGAACCACGCTGAAG
CCCAGGAGGTCACAATTGGCCCCCAGTCGGTGGCTGTAGCCCGCTGTGTCTCCACTGGGGGCCGCCCCCCTGCCCGAATC
ACCTGGATCTCATCTCTGGGTGGAGAGGCCAAAGATACTCAGGAGCCAGGGATACAGGCTGGCACGGTCACTATCATCA
Sequence Type mRNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20318378..20323725 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es