Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD075
Clone ID CSD075
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD075
Sequence
ATCCTGTGGTCGCCCTTGTTTTCCAGAACACTGCCCTTTTTTCCCGCGCGGTCTGCTCCTCTAGTTCACCTCGGATAATG
GCGACAGCCGT
Sequence Type mRNA
Unitrap ID UNI5422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77380768..77380858 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es