Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST207189
Clone ID OST207189
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST207189
Sequence
GACTGAGGCAAGATCCCAATCTCAGGGCCCCCTGGGGCCATCATGCCAGCTGGGGGCCGGGCCGGGAGCCTGAAGGACCC
TGATGTGGCTGAGCTCTTCTTCAAGGATGACCCTGAGAAGCTCTTCTCTGACCTCCGGNAGATCGNCCATGGCAGCNTTT
GGAGCAGAGTACTTTG
Sequence Type mRNA
Unitrap ID UNI24337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134024010..134024179 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059981 (Taok2) TAO kinase 2 Gene [Source:MGI (curated);Acc:Taok2-001]

 
Come back to gene ENSMUSG00000059981


For any suggestions or comments, please send an email to unitrap@crg.es