Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST206974
Clone ID OST206974
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST206974
Sequence
ACTGAGGCCGGAGTGATGGTGAAAGCATTGGAACTGCCCCTTTTCACAGAGGCTCTTCATGATCCTTTGGCTCAAAGGAG
TCGTGTTCAGTGTCACAACCGTTGACCTGAAAAGGAAACCTGCAGATCTACAGAACTTGGCTCCTGGGACCCACCCGCCA
TTTATAACCTTCAACAGCGAAGTCAAGACGGATGTGAATAAGATTGAGGAATTTCTCGAAGAAGTCTTGTGCCCACCCAA
GTGAGTATCTGACCATTTGGACATACTGCCCCGCTTTGAAGCTTTGACCTTCTTGTCTCCGGACACTTTTTTCCTGAGGG
ACTTTAAATTCTCAGGGCCTNTGATTGGAATAACCAGGACACGCTTGTAAGAGTAATGCTTANTCAGTGGCAGAATGGGC
TTTTTGNTTANCCATACTAANAAAGACTGGGGGNTGGTGTGATGGCTCAACNGGGNAACAGNACCNCACTGCTCTTTCNA
AAGGTCTANANGTTCAANNTCNCCAACACCCACATGNNGACTTCACAACCATCCCNAACCAAAATCTAACCCCCTCTTTC
T
Sequence Type mRNA
Unitrap ID UNI7776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134781629..134794888 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es