Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSD148
Clone ID CSD148
Vector pGT0Lxf
Project baygenomics

Sequence tag CSD148
Sequence
GGCCATTTTGCCGTGAGACAGCAGGAGTTAGGCGCGATGCTTTCCACTGCTGCTTACCGAGACGTGGAACGAGAGCTGGG
AATGGGGCCTCACGGCTCCGCCGGCCCTGTGCAGCTGCGGTTTTCGCCTTATGCCTTCAACGGAGGTACTGTATTGGCAA
TTGCTGGAGAAGATTTTTCCATCGTCGCTTCAGACACTCGATTGAGTGAAGGATTTTCAATTCATACCCGAGATAGCCCC
AAATGCTACAAACTGACAGACAAGACAGTAATTGGCTGCAGTGGTTTCCATGGAGATTGTCTCACTTTGACAAAGATTAT
TGAAGCAAGATTAAAGATGTACAAGCATTCCAATAACAAGGCCATGACAACGGGGGCGATTGCTGCAATGCTGTCTACCA
TCCTGTACTCACGGCGCTTCTTCCCTTACTATGTTTACAACATCATTGGAGGACTTGATGAAGA
Sequence Type mRNA
Unitrap ID UNI1644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15627122..15635262 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014769 (Psmb1) NM_011185 proteasome (prosome, macropain) subunit, beta type 1 Gene [Source:MGI Symbol;Acc:MGI:104884]

 
Come back to gene ENSMUSG00000014769


For any suggestions or comments, please send an email to unitrap@crg.es